S performed four times using the Upstate EZ-Chip protocol for suspension

S performed four times using the Upstate EZ-Chip protocol for suspension cells with 5 mg of the goat polyclonal antibody, anti-Mef2c (Santa Cruz, sc-13266) andIn Situ HybridizationSection in situ hybridization was performed as described [24]. Probes were made by isolating total RNA from mouse embryonic tissues, using the RNeasy minikit (Qiagen #74104), and synthesizing cDNA using the Stratascript first strand kit (Stratagene #200420). Following cDNA synthesis, a PCR product was amplified using primers for Cartilage Link Protein 1 (Ctrl1) sense (59-tggaccaggacgcagtgatt-39) and antisense (59-gcagcggtcatagcccagaa-39) with the addition of Sp6 or T7 polymerase promoters. TheMef2c Regulates Crtl1 TranscriptionTable 1. DNA Precipitation Oligonucleotides.Oligonucleotide Positive INCB-039110 chemical information control Mef2 sense Positive control Mef2 antisense Negative control Mef2 sense Negative control Mef2 antisense Mef2 wildtype site 2707 to 2698 sense Mef2 wildtype site 2707 to 2698 antisense Mef2 mutated site 2707 to 2698 sense Mef2 mutated site 2707 to 2698 antisense Mef2 wildtype site 2922 to 2913 sense Mef2 wildtype site 2922 to 2913 antisense Mef2 mutated site 2922 to 2913 sense Mef2 mutated site 2922 to 2913 antisense doi:10.1371/journal.pone.0057073.tSequence 59 [biotin]-tcgctctaaaaataaccctcaagctctaaaaataaccctgtcactctaaaaataaccctgag 59-ctcagggttatttttagagtgacagggttatttttagagcttgagggttatttttagagcga 59 [biotin]- tcgctaaagcgaaccctcaagctaaagcgaaccctgtcactctaaagcgaaccctgag 59-ctcagggttcgctttagagtgacagggttcgctttagagcttgagggttcgctttagagcga 59 [biotin]- tcccccttgcattcctcactctataaataaactcaggttcttaggcacta 59-tagtgcctaagaacctgagtttatttatagagtgaggaatgcaaggggga 59 [biotin]- tcccccttgcattcctcactctatagcgaaactcaggttcttaggcacta 59-tagtgcctaagaacctgagtttcgctatagagtgaggaatgca-aggggga 59 [biotin]-tatactctccctcgagttataaataaatgtctatttgttcaggaggaggtt 59-aacgcctcctgaacaaatagacatttatttataactcgagggagagtata 59 [biotin] tatactctccctcgagttatagcgaaatgtctatttgttcaggaggcgtt 59-aacgcctcctgaacaaatagacatttcgctataactcgagggagagtata5 mg of normal goat IgG (Santa Cruz, sc-2028) as an isotype control. Using the same protocol, Chromatin Immunoprecipitation was also performed two times with 1 mg of the rabbit polyclonal antibodies: anti-Mef2c (Sigma, HPA00553) and antiSox9 (Santa Cruz, sc-20095) and 1 mg of normal rabbit IgG (Caltag, #Emixustat (hydrochloride) supplier 10500C) as an isotype control. Immunoprecipitated DNA was PCR amplified using primers designed to amplify the mouse Crtl1 promoter sequence spanning both the Mef2 binding sites at 2707 to 2698 (59-ctataaataa-39) and at 2913 to 2923 (59ttataaataa-39); forward primer (59-ccaatcaaaggtggctctgt-39) and reverse primer (59-acccagattgcttgttttgc-39). The same immunoprecipitated DNA was also PCR amplified to asses binding to the Sox9 consensus site of the mouse Crtl1 promoter using the forward primer (59-atcctcggatcaggacctct-39) and the reverse primer (59aaacccaccaaacagaaacg-39).NIH3T3 Cell CultureNIH3T3 cells were cultured at 37uC with 5 CO2 in high glucose DMEM (Fisher, #SH3028501) with 10 fetal bovine serum (Fisher, #SH3007001), 1 penicillin/streptomycin, and 4 mM L-Glutamine (Fisher, #SH3003401).Luciferase AssayPrimary chick mitral VICs were plated after 2? passages at a cell density of 16105 and transfected in triplicate with the following constructs: mCrtl1, mMef2c, Mef2-Engrailed, and pGL3-Basic as a control. NIH3T3 cells were plated at a cell density of 26105 and transfected in triplicate with Crtl1, Crtl1Mutant1, Crtl1-Mutant2, mMef2c, and pGL3-Basic as a control. In both.S performed four times using the Upstate EZ-Chip protocol for suspension cells with 5 mg of the goat polyclonal antibody, anti-Mef2c (Santa Cruz, sc-13266) andIn Situ HybridizationSection in situ hybridization was performed as described [24]. Probes were made by isolating total RNA from mouse embryonic tissues, using the RNeasy minikit (Qiagen #74104), and synthesizing cDNA using the Stratascript first strand kit (Stratagene #200420). Following cDNA synthesis, a PCR product was amplified using primers for Cartilage Link Protein 1 (Ctrl1) sense (59-tggaccaggacgcagtgatt-39) and antisense (59-gcagcggtcatagcccagaa-39) with the addition of Sp6 or T7 polymerase promoters. TheMef2c Regulates Crtl1 TranscriptionTable 1. DNA Precipitation Oligonucleotides.Oligonucleotide Positive control Mef2 sense Positive control Mef2 antisense Negative control Mef2 sense Negative control Mef2 antisense Mef2 wildtype site 2707 to 2698 sense Mef2 wildtype site 2707 to 2698 antisense Mef2 mutated site 2707 to 2698 sense Mef2 mutated site 2707 to 2698 antisense Mef2 wildtype site 2922 to 2913 sense Mef2 wildtype site 2922 to 2913 antisense Mef2 mutated site 2922 to 2913 sense Mef2 mutated site 2922 to 2913 antisense doi:10.1371/journal.pone.0057073.tSequence 59 [biotin]-tcgctctaaaaataaccctcaagctctaaaaataaccctgtcactctaaaaataaccctgag 59-ctcagggttatttttagagtgacagggttatttttagagcttgagggttatttttagagcga 59 [biotin]- tcgctaaagcgaaccctcaagctaaagcgaaccctgtcactctaaagcgaaccctgag 59-ctcagggttcgctttagagtgacagggttcgctttagagcttgagggttcgctttagagcga 59 [biotin]- tcccccttgcattcctcactctataaataaactcaggttcttaggcacta 59-tagtgcctaagaacctgagtttatttatagagtgaggaatgcaaggggga 59 [biotin]- tcccccttgcattcctcactctatagcgaaactcaggttcttaggcacta 59-tagtgcctaagaacctgagtttcgctatagagtgaggaatgca-aggggga 59 [biotin]-tatactctccctcgagttataaataaatgtctatttgttcaggaggaggtt 59-aacgcctcctgaacaaatagacatttatttataactcgagggagagtata 59 [biotin] tatactctccctcgagttatagcgaaatgtctatttgttcaggaggcgtt 59-aacgcctcctgaacaaatagacatttcgctataactcgagggagagtata5 mg of normal goat IgG (Santa Cruz, sc-2028) as an isotype control. Using the same protocol, Chromatin Immunoprecipitation was also performed two times with 1 mg of the rabbit polyclonal antibodies: anti-Mef2c (Sigma, HPA00553) and antiSox9 (Santa Cruz, sc-20095) and 1 mg of normal rabbit IgG (Caltag, #10500C) as an isotype control. Immunoprecipitated DNA was PCR amplified using primers designed to amplify the mouse Crtl1 promoter sequence spanning both the Mef2 binding sites at 2707 to 2698 (59-ctataaataa-39) and at 2913 to 2923 (59ttataaataa-39); forward primer (59-ccaatcaaaggtggctctgt-39) and reverse primer (59-acccagattgcttgttttgc-39). The same immunoprecipitated DNA was also PCR amplified to asses binding to the Sox9 consensus site of the mouse Crtl1 promoter using the forward primer (59-atcctcggatcaggacctct-39) and the reverse primer (59aaacccaccaaacagaaacg-39).NIH3T3 Cell CultureNIH3T3 cells were cultured at 37uC with 5 CO2 in high glucose DMEM (Fisher, #SH3028501) with 10 fetal bovine serum (Fisher, #SH3007001), 1 penicillin/streptomycin, and 4 mM L-Glutamine (Fisher, #SH3003401).Luciferase AssayPrimary chick mitral VICs were plated after 2? passages at a cell density of 16105 and transfected in triplicate with the following constructs: mCrtl1, mMef2c, Mef2-Engrailed, and pGL3-Basic as a control. NIH3T3 cells were plated at a cell density of 26105 and transfected in triplicate with Crtl1, Crtl1Mutant1, Crtl1-Mutant2, mMef2c, and pGL3-Basic as a control. In both.