Nanoparticles carrying chemical therapeutics have shown great promise in treating cancer patients

nitrocellulose and developed using appropriate primary and secondary antibodies. 17568748 Proteins were separated at 120 volts for approximately 2 hours and then transferred at 110 volts for 1 hour to nitrocellulose membranes. Membranes were blocked with milk or bovine serum albumin diluted in tris-buffered saline with tween for 1 hour and then incubated in primary antibody overnight at 4C. Antibodies and their dilution used with whole muscle or isolated mitochondria immunoblots are as follows: Anti-Tfam was from Santa Cruz. The MitoProfile total OXPHOS, anti-nitro tyrosine, 4HNE, anti-Sod2, anti-Ogg1 and anti-UCP3 antibodies were from Abcam. Anti-VDAC 4661, 1:3000 was from Cell Signaling. Anti-ANT1 antibody was acquired from MitoSciences. For determination of protein carbonyls, samples were derivatized and detected using a kit from Millipore. After primary incubation, all blots were washed 3 times in TBS-T and incubated in respective antimouse, anti-rabbit or anti-goat secondary antibodies at room temperature for 1 hour. Subsequently, membranes were developed with ECL plus and exposed to x-ray film. All films were digitized and band density was MLN1117 determined using ImageJ. Mitochondrial 8-OH-dG mtDNA was isolated from resuspended mitochondria using the QIAamp DNA mini kit. DNA concentration was determined using PicoGreen dye and a lambda DNA standard curve, followed by digestion to single bases using a one-step Benzonase protocol as described. Digested bases were analyzed for 8-hydroxy-2-deoxyguanosine in duplicate using a commercially available kit and the amount of 8-OH-dG present in each sample was normalized to initial mtDNA content. mtDNA Copy Number Analysis Total DNA was isolated from 20 mg of tibialis anterior muscle using the QIAamp DNA mini kit. The abundance of a mitochondrial DNA gene relative to a nuclear gene was determined using quantitative real-time PCR according to the 2 -Ct method. Primer sequences are as follows: COXII, forward: gccgactaaatcaagcaaca, reverse: caatgggcataaagctatgg; globin, forward: gaagcgattctagggagcag, reverse: ggagcagcgattctgagtaga. Muscle Fiber Permeabilization and Mitochondrial Respiration A portion of freshly isolated quadriceps femoris muscle was placed into ice-cold permeabilization solution to isolate fiber bundles as described. Muscle was carefully dissected free of any fat and connective tissue and separated into bundles under a dissection microscope with fine forceps for 20 minutes. Fibers were then collected, immersed in fresh BIOPS solution supplemented with saponin and incubated at 4C on a rotator for 30 mins. Bundles were then washed twice in respiration buffer, pH 7.1) for 5 mins on a rotator at 4C to remove any residual permeabilization solution. Permeabilized fiber bundles were blotted dry, weighed and transferred to a highresolution respirometer containing air saturated respiration buffer at 37C and the chamber was closed. Standardized calibrations to correct for background oxygen flux were completed prior to performing the experimental procedures. All experiments were performed in duplicate, simultaneously. Basal respiration without adenylates was obtained by the addition of 10 mM glutamate and 2 mM malate as substrates of complex I. This was followed by injection of 2.5 mM ADP 15102954 to assess oxidative phosphorylation through complex I. The subsequent addition of succinate provided the measurement of convergent electron flux through complexes I and II. Mitochondrial outer membrane intactness was t