Some flanking gene families we run phylogenetics to confirm relationships with

Some flanking gene families we run phylogenetics to confirm relationships with the methodology described above (not shown).Gene transcription analysisprimers were designed using sequences available in Ensembl with Primer3 software [39]. All of primer sets match exon sequence and flank an intron consequently avoiding genomic DNA amplification. Primers sets were created for the following genes ACSL1a; (Forward5 CAGGATGGGCAAAGAATAGAG 3, Reverse-5 TTT CAGTGTTGGTGTGAGGAG 3, annealing at 55 ) ACSL1b; (Forward-5 GCACAGCGAGATGTTCAC 3, Reverse-5 AAGTCCAATCCAAATGTCAGG 3, annealing at 54 ) ASCL2 gene; (Forward-5 GTAGTTCCAGATCCA GAAGTGTTC 3 reverse-5 CGCCGTCATGTCCTCCAG 3, annealing at 56 ) ACSL5; (Forward-5 CGCAGAGAA ACTGGGATTGAAAGG 3, Reverse-5 TGGCTTTGAGT GTTGGAGTGAGG 3, annealing at 58 ) and ASCL6 (Forward-5 CCTCGTGGGCTCAGAAGAAAG 3 Reverse5CGCACCATGTCCTCCAGAATA 3, annealing at 58 ). PCR was performed using 2 l of zebrafish cDNA and PhusionFlash high-fidelity Master Mix (FINNZYMES). PCR parameters were as follows: initial denaturation at 98 for 10 s, followed by 35 cycles of denaturation at 98 for 1 s, annealing for 5 s and elongation at 72 for 10s and a final step of elongation at 72 for 1 min. PCR products were then loaded onto 2 agarose gel stained with GelRed and run in TBE buffer at 80 V. In silico expression analysis, for ACSL gene in Human, was performed using ESTs available from Unigene [40] as count per million transcripts, all values are displayed as Log2 transcripts per million. Heat map was created using the collected EST data and matrix2png web interface v1.2 [41].Additional filesAdditional file 1: tBlastn search of ACSLlike sequences in Transcriptomic contigs. Additional file 2: Partial Acsl gene annotations in green spotted pufferfish. Additional file 3: NCBI accession numbers and Ensembl gene ID.Taurine Additional file 4: Synteny maps of Zebrafish ACSL 3R duplicates.Menaquinone-7 Additional file 5: Xenopus tropicalis Acsl4 and Acsl3 corresponding location in human.PMID:24220671 Competing interests The authors declare that they have no competing interests. Authors’ contributions The original idea for this study was conceived by LFCC. LFCC and MLM performed all the experimental analysis; MMS, MARH, and IC participated in the discussion regarding lipid metabolism and physiology. The manuscript was written by LFCC and MLM, and edited by all other co-authors. All authors have read and approved the final manuscript. Acknowledgements This work was supported by Funda o para a Ci cia e a Tecnologia (Portugal), through grants PTDC/MAR/68106/2006 and PTDC/MAR/68885/2006, the European Regional Development Fund (ERDF) through the COMPETE Operational Competitiveness Programme and national funds through FCT Funda o para a Ci cia e a Tecnologia, under the project “PEst-C/MAR/ LA0015/2013, and SFRH/BD/84238/2012 awarded to M Lopes-Marques. We thank three anonymous reviewers for their insightfull comments.Adult wild-type zebrafish obtained from our own breeding stock were used for gene expression analysis. Animals were anesthetized and killed by cervical transection in accordance with the Portuguese Animals and Welfare Law (Decreto-Lei n197/96) approved by the Portuguese Parliament in 1996. Institutional animal approval by CIIMAR/UP and DGV (Ministry of Agriculture) was granted for this study. After collection all tissues were preserved in RNAlater and stored at -20 . Total RNA was isolated using an Illustra RNAspin Mini RNA Isolation Kit (GE Healthcare, UK) according to the.